Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
circRNA_100290/hsa_circ_0013339/hsa_circ_100290 | |||
Gene | SLC30A7 | Organism | Human |
Genome Locus | chr1:101372407-101379362:+ | Build | hg19 |
Disease | Oral Squamous Cell Carcinoma | ICD-10 | Carcinoma in situ of oral cavity, oesophagus and stomach (D00) |
DBLink | Link to database | PMID | 28368401 |
Experimental Method | |||
Sample Type | Tissues | Comparison | Oral Squamous Cell Carcinoma (OSCC) tissue and paired non-cancerous matched tissue |
Method for Estimation | Quantitative PCR and Microarrays | PCR Details | |
Primers (Experimented) | Forward GTCATTCCCTCTTTAATGGTG ReverseCAGAACTTCCGCTCTAACATAC | Statistics | Fold Change : Upregulated,6.9112928. pvalue : p=0.000011097 |
Citation | |||
Chen, L, Zhang, S, Wu, J, Cui, J, Zhong, L, Zeng, L, Ge, S (2017). circRNA_100290 plays a role in oral cancer by functioning as a sponge of the miR-29 family. Oncogene, 36, 32:4551-4561. |